{ "x402Version": 2, "category": "Healthcare", "total": 15, "limit": 100, "offset": 0, "resources": [ { "id": 54490, "slug": "54490", "resource": "https://monitor.memoryapi.org/x402/monitor/activity", "description": "x402 API activity stats — top endpoints by paid calls, trend data, and unique payer counts from memoryapi.org nginx logs.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x24FAcafEB49b4e3FACF0B3e69604A2F4640c9bf2", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "1000", "amountUsd": 0.001, "maxTimeoutSeconds": 300 } ], "outputSchema": { "example": { "period_hours": 24, "source": "memoryapi.org nginx logs", "success": true, "top_endpoints": [ { "calls": 87, "endpoint": "/x402/clinical/study", "trend": "up" } ], "total_paid_calls": 142 } }, "extensions": { "bazaar": { "info": { "description": "Get x402 paid API call activity from memoryapi.org. Returns top endpoints, call counts, and trends.", "iconUrl": "https://memoryapi.org/icon.png", "input": { "method": "GET", "queryParams": { "hours": "24", "service": "clinical" }, "schema": { "properties": { "hours": { "description": "Lookback window in hours (1-168, default 24)", "type": "string" }, "service": { "description": "Filter by service name (e.g. clinical, bio, research)", "type": "string" } }, "required": [] }, "type": "http" }, "output": { "example": { "period_hours": 24, "source": "memoryapi.org nginx logs", "success": true, "top_endpoints": [ { "calls": 87, "endpoint": "/x402/clinical/study", "trend": "up" } ], "total_paid_calls": 142 } }, "serviceName": "MemoryAPI Monitor", "tags": [ "monitoring", "analytics", "agents" ] }, "schema": { "properties": { "input": { "properties": { "method": { "enum": [ "GET" ], "type": "string" } }, "required": [ "method" ] } } } } }, "tags": [ "bazaar" ], "sourceHost": "monitor.memoryapi.org", "lastUpdated": "2026-10-08T05:40:04.691Z", "quality": { "calls30d": 7, "uniquePayers30d": 6, "lastCalledAt": "2026-10-08T05:40:04.501Z" }, "metadata": { "extensions": { "bazaar": { "info": { "description": "Get x402 paid API call activity from memoryapi.org. Returns top endpoints, call counts, and trends.", "iconUrl": "https://memoryapi.org/icon.png", "input": { "method": "GET", "queryParams": { "hours": "24", "service": "clinical" }, "schema": { "properties": { "hours": { "description": "Lookback window in hours (1-168, default 24)", "type": "string" }, "service": { "description": "Filter by service name (e.g. clinical, bio, research)", "type": "string" } }, "required": [] }, "type": "http" }, "output": { "example": { "period_hours": 24, "source": "memoryapi.org nginx logs", "success": true, "top_endpoints": [ { "calls": 87, "endpoint": "/x402/clinical/study", "trend": "up" } ], "total_paid_calls": 142 } }, "serviceName": "MemoryAPI Monitor", "tags": [ "monitoring", "analytics", "agents" ] }, "schema": { "properties": { "input": { "properties": { "method": { "enum": [ "GET" ], "type": "string" } }, "required": [ "method" ] } } } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 54493, "slug": "54493", "resource": "https://bio.halowerk.com/v1/crispr-offtarget", "description": "Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "4000", "amountUsd": 0.004, "maxTimeoutSeconds": 300 } ], "extensions": { "bazaar": { "info": { "input": { "body": { "candidates": [ { "id": "candidate-1", "pam": "AGG", "protospacer": "GAGTCCGAGCAGAAGAAGAA" }, { "id": "candidate-2", "pam": "TGG", "protospacer": "GAGTCCGAGCAGAAGATGAA" }, { "id": "candidate-3", "pam": "TGA", "protospacer": "GACTCCGAGCAGAAGAAGAT" } ], "guide": "GAGTCCGAGCAGAAGAAGAA" }, "bodyType": "json", "method": "POST", "type": "http" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "additionalProperties": false, "properties": { "candidates": { "items": { "additionalProperties": false, "properties": { "id": { "maxLength": 128, "minLength": 1, "type": "string" }, "pam": { "maxLength": 8, "minLength": 2, "pattern": "^[ACGT]+$", "type": "string" }, "protospacer": { "maxLength": 30, "minLength": 17, "pattern": "^[ACGT]+$", "type": "string" } }, "required": [ "id", "protospacer", "pam" ], "type": "object" }, "maxItems": 1000, "minItems": 1, "type": "array" }, "guide": { "description": "Guide sequence written 5-prime to 3-prime.", "maxLength": 30, "minLength": 17, "pattern": "^[ACGT]+$", "type": "string" } }, "required": [ "guide", "candidates" ], "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST", "PUT", "PATCH" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "bazaar" ], "sourceHost": "bio.halowerk.com", "lastUpdated": "2026-10-08T06:13:32.281Z", "quality": { "calls30d": 4, "uniquePayers30d": 4, "lastCalledAt": "2026-10-08T06:13:32.051Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "candidates": [ { "id": "candidate-1", "pam": "AGG", "protospacer": "GAGTCCGAGCAGAAGAAGAA" }, { "id": "candidate-2", "pam": "TGG", "protospacer": "GAGTCCGAGCAGAAGATGAA" }, { "id": "candidate-3", "pam": "TGA", "protospacer": "GACTCCGAGCAGAAGAAGAT" } ], "guide": "GAGTCCGAGCAGAAGAAGAA" }, "bodyType": "json", "method": "POST", "type": "http" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "additionalProperties": false, "properties": { "candidates": { "items": { "additionalProperties": false, "properties": { "id": { "maxLength": 128, "minLength": 1, "type": "string" }, "pam": { "maxLength": 8, "minLength": 2, "pattern": "^[ACGT]+$", "type": "string" }, "protospacer": { "maxLength": 30, "minLength": 17, "pattern": "^[ACGT]+$", "type": "string" } }, "required": [ "id", "protospacer", "pam" ], "type": "object" }, "maxItems": 1000, "minItems": 1, "type": "array" }, "guide": { "description": "Guide sequence written 5-prime to 3-prime.", "maxLength": 30, "minLength": 17, "pattern": "^[ACGT]+$", "type": "string" } }, "required": [ "guide", "candidates" ], "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST", "PUT", "PATCH" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 35751, "slug": "35751", "resource": "https://market.561.group/v1/pacing/heart-rate-threshold", "description": "Heart-Rate Threshold: the Workwell Foundation resting-heart-rate+15bpm pacing-ceiling heuristic, labeled as an unvalidated clinical rule of thumb. Stateless: nothing submitted or computed is stored.", "type": "http", "serviceName": "561-group-hr-threshold", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x32886F6F361C1d570255c2762967A2e41D0E9B1a", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 300 } ], "outputSchema": { "properties": { "example": { "properties": { "ceilingBpm": { "type": "number" }, "evidenceStatus": { "type": "string" }, "formula": { "type": "string" }, "restingHr": { "type": "number" } }, "required": [ "ceilingBpm", "restingHr", "formula", "evidenceStatus" ], "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "restingHr": 58 }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "ceilingBpm": 73, "evidenceStatus": "Workwell Foundation clinical rule of thumb; no validating primary study found (targeted PubMed search, 2026-09-01). Present as an informal heuristic, never as a validated instrument.", "formula": "resting heart rate + 15 bpm", "restingHr": 58 }, "type": "json" } }, "routeTemplate": "/v1/pacing/heart-rate-threshold", "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "restingHr": { "description": "Resting heart rate in beats per minute.", "exclusiveMinimum": 0, "type": "number" } }, "required": [ "restingHr" ] }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST", "PUT", "PATCH" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "properties": { "ceilingBpm": { "type": "number" }, "evidenceStatus": { "type": "string" }, "formula": { "type": "string" }, "restingHr": { "type": "number" } }, "required": [ "ceilingBpm", "restingHr", "formula", "evidenceStatus" ], "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } }, "sign-in-with-x": { "info": { "domain": "market.561.group", "expirationTime": "2026-10-07T16:00:03.247Z", "issuedAt": "2026-10-07T15:55:03.247Z", "nonce": "13b1657b238c09a5583e31c2cd903e0f", "resources": [ "https://market.561.group/v1/pacing/heart-rate-threshold" ], "statement": "Sign in to use what this wallet has been granted at market.561.group.", "uri": "https://market.561.group/v1/pacing/heart-rate-threshold", "version": "1" }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "address": { "type": "string" }, "chainId": { "type": "string" }, "domain": { "type": "string" }, "expirationTime": { "type": "string" }, "issuedAt": { "type": "string" }, "nonce": { "type": "string" }, "notBefore": { "type": "string" }, "requestId": { "type": "string" }, "signature": { "type": "string" }, "statement": { "type": "string" }, "type": { "type": "string" }, "uri": { "type": "string" }, "version": { "type": "string" } }, "required": [ "domain", "address", "uri", "version", "chainId", "type", "nonce", "issuedAt", "signature" ], "type": "object" }, "supportedChains": [ { "chainId": "eip155:8453", "type": "eip191" } ] } }, "tags": [ "pacing", "biometric", "heart-rate", "workwell", "heuristic", "bazaar", "sign-in-with-x" ], "sourceHost": "market.561.group", "lastUpdated": "2026-10-07T15:55:03.365Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-07T15:55:01.972Z" }, "metadata": { "serviceName": "561-group-hr-threshold", "extensions": { "bazaar": { "info": { "input": { "body": { "restingHr": 58 }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "ceilingBpm": 73, "evidenceStatus": "Workwell Foundation clinical rule of thumb; no validating primary study found (targeted PubMed search, 2026-09-01). Present as an informal heuristic, never as a validated instrument.", "formula": "resting heart rate + 15 bpm", "restingHr": 58 }, "type": "json" } }, "routeTemplate": "/v1/pacing/heart-rate-threshold", "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "restingHr": { "description": "Resting heart rate in beats per minute.", "exclusiveMinimum": 0, "type": "number" } }, "required": [ "restingHr" ] }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST", "PUT", "PATCH" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "properties": { "ceilingBpm": { "type": "number" }, "evidenceStatus": { "type": "string" }, "formula": { "type": "string" }, "restingHr": { "type": "number" } }, "required": [ "ceilingBpm", "restingHr", "formula", "evidenceStatus" ], "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } }, "sign-in-with-x": { "info": { "domain": "market.561.group", "expirationTime": "2026-10-07T16:00:03.247Z", "issuedAt": "2026-10-07T15:55:03.247Z", "nonce": "13b1657b238c09a5583e31c2cd903e0f", "resources": [ "https://market.561.group/v1/pacing/heart-rate-threshold" ], "statement": "Sign in to use what this wallet has been granted at market.561.group.", "uri": "https://market.561.group/v1/pacing/heart-rate-threshold", "version": "1" }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "address": { "type": "string" }, "chainId": { "type": "string" }, "domain": { "type": "string" }, "expirationTime": { "type": "string" }, "issuedAt": { "type": "string" }, "nonce": { "type": "string" }, "notBefore": { "type": "string" }, "requestId": { "type": "string" }, "signature": { "type": "string" }, "statement": { "type": "string" }, "type": { "type": "string" }, "uri": { "type": "string" }, "version": { "type": "string" } }, "required": [ "domain", "address", "uri", "version", "chainId", "type", "nonce", "issuedAt", "signature" ], "type": "object" }, "supportedChains": [ { "chainId": "eip155:8453", "type": "eip191" } ] } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 44900, "slug": "44900", "resource": "https://market.datapackvibe.com/x402/pulse-web-clinical-trial-record-search-operators", "description": "Clinical trial record search for Operations teams: Search live public web pages about clinical trial record search, focused on operations teams. Returns source links and snippets, not endorsements.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x8bc2AECdD86097F74a1a5fa17764108D9a683C8C", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 120 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Operations teams" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Operations teams", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-operators", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Operations teams", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "web-intelligence", "clinical-trial-record-search", "operators", "live-data", "agent-service", "bazaar" ], "sourceHost": "market.datapackvibe.com", "lastUpdated": "2026-10-03T13:32:42.893Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-03T13:32:42.69Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Operations teams" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Operations teams", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-operators", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Operations teams", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 44901, "slug": "44901", "resource": "https://market.datapackvibe.com/x402/pulse-web-clinical-trial-record-search-developers", "description": "Clinical trial record search for Developers: Search live public web pages about clinical trial record search, focused on developers. Returns source links and snippets, not endorsements.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x8bc2AECdD86097F74a1a5fa17764108D9a683C8C", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 120 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Developers" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Developers", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-developers", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Developers", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "web-intelligence", "clinical-trial-record-search", "developers", "live-data", "agent-service", "bazaar" ], "sourceHost": "market.datapackvibe.com", "lastUpdated": "2026-10-03T13:32:41.061Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-03T13:32:40.849Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Developers" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Developers", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-developers", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Developers", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 44902, "slug": "44902", "resource": "https://market.datapackvibe.com/x402/pulse-web-clinical-trial-record-search-analysts", "description": "Clinical trial record search for Analysts: Search live public web pages about clinical trial record search, focused on analysts. Returns source links and snippets, not endorsements.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x8bc2AECdD86097F74a1a5fa17764108D9a683C8C", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 120 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Analysts" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Analysts", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-analysts", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Analysts", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "web-intelligence", "clinical-trial-record-search", "analysts", "live-data", "agent-service", "bazaar" ], "sourceHost": "market.datapackvibe.com", "lastUpdated": "2026-10-03T13:32:37.658Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-03T13:32:37.444Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Analysts" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Analysts", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-analysts", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Analysts", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 44903, "slug": "44903", "resource": "https://market.datapackvibe.com/x402/pulse-web-clinical-trial-record-search-agent-builders", "description": "Clinical trial record search for Agent builders: Search live public web pages about clinical trial record search, focused on agent builders. Returns source links and snippets, not endorsements.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x8bc2AECdD86097F74a1a5fa17764108D9a683C8C", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 120 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Agent builders" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Agent builders", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-agent-builders", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Agent builders", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "web-intelligence", "clinical-trial-record-search", "agent-builders", "live-data", "agent-service", "bazaar" ], "sourceHost": "market.datapackvibe.com", "lastUpdated": "2026-10-03T13:32:35.737Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-03T13:32:35.447Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial registry record status official sources Agent builders" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial registry record status official sources Agent builders", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-web-clinical-trial-record-search-agent-builders", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial registry record status official sources Agent builders", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 45000, "slug": "45000", "resource": "https://market.datapackvibe.com/x402/pulse-news-clinical-trials-operators", "description": "Clinical trials updates for Operations teams: Search recent Google News RSS coverage of clinical trials for operations teams. Returns publisher links and dates.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x8bc2AECdD86097F74a1a5fa17764108D9a683C8C", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 120 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial recruitment registry research news Operations teams" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial recruitment registry research news Operations teams", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-news-clinical-trials-operators", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial recruitment registry research news Operations teams", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "news-intelligence", "clinical-trials", "operators", "live-data", "agent-service", "bazaar" ], "sourceHost": "market.datapackvibe.com", "lastUpdated": "2026-10-03T10:02:49.166Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-03T10:02:48.96Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial recruitment registry research news Operations teams" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial recruitment registry research news Operations teams", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-news-clinical-trials-operators", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial recruitment registry research news Operations teams", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 45001, "slug": "45001", "resource": "https://market.datapackvibe.com/x402/pulse-news-clinical-trials-buyers", "description": "Clinical trials updates for Technology buyers: Search recent Google News RSS coverage of clinical trials for technology buyers. Returns publisher links and dates.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x8bc2AECdD86097F74a1a5fa17764108D9a683C8C", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "10000", "amountUsd": 0.01, "maxTimeoutSeconds": 120 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial recruitment registry research news Technology buyers" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial recruitment registry research news Technology buyers", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-news-clinical-trials-buyers", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial recruitment registry research news Technology buyers", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "news-intelligence", "clinical-trials", "buyers", "live-data", "agent-service", "bazaar" ], "sourceHost": "market.datapackvibe.com", "lastUpdated": "2026-10-03T10:02:45.424Z", "quality": { "calls30d": 2, "uniquePayers30d": 2, "lastCalledAt": "2026-10-03T10:02:45.216Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "body": { "max_results": 5, "query": "clinical trial recruitment registry research news Technology buyers" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "files": [], "order_id": "ord_example", "result": { "query": "clinical trial recruitment registry research news Technology buyers", "results": [ { "snippet": "A paid call returns current source links.", "title": "Example only", "url": "https://example.com/" } ] }, "sku": "pulse-news-clinical-trials-buyers", "status": "delivered" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "properties": { "max_results": { "default": 5, "maximum": 10, "minimum": 1, "type": "integer" }, "query": { "default": "clinical trial recruitment registry research news Technology buyers", "description": "Optional focused query.", "type": "string" } }, "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 14082, "slug": "14082", "resource": "https://petpulse.theaslangroupllc.com/api/pet/behavior", "description": "Dog and cat behavior and training guide for pet-owner and trainer agents. Returns force-free, positive-reinforcement step-by-step guidance for behavior issues (separation anxiety, leash reactivity, litter box avoidance, destructive chewing, aggression, and more) worldwide, with honest timelines and red flags for when a certified behaviorist or veterinarian is needed. Pet-info guide, not a veterinary or clinical behavioral diagnosis.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "100000", "amountUsd": 0.1, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:8453", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "100000", "amountUsd": 0.1, "maxTimeoutSeconds": 604900 }, { "scheme": "exact", "network": "solana:5eykt4UsFv8P8NJdTREpY1vzqKqZKvdp", "payTo": "985iFjbnGQ3dJcwXnfRCMSrH4Jnc3kW1N6msR64B5KX1", "asset": "EPjFWdd5AufqSSqeM2qN1xzybapC8G4wEGGkZwyTDt1v", "amount": "100000", "amountUsd": 0.1, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:137", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x3c499c542cEF5E3811e1192ce70d8cC03d5c3359", "amount": "100000", "amountUsd": 0.1, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:42161", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0xaf88d065e77c8cC2239327C5EDb3A432268e5831", "amount": "100000", "amountUsd": 0.1, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:480", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x79A02482A880bCe3F13E09da970dC34dB4cD24D1", "amount": "100000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:143", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x754704Bc059F8C67012fEd69BC8A327a5aafb603", "amount": "100000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:196", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x779ded0c9e1022225f8e0630b35a9b54be713736", "amount": "100000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:999", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0xb88339CB7199b77E23DB6E890353E22632Ba630f", "amount": "100000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "algorand:wGHE2Pwdvd7S12BL5FaOP20EGYesN73k", "payTo": "62A253YPATFNJCPRKID3FKD77MYJFNTVRYRP4B4JWG36EGLPY7UXFWGI7I", "asset": "31566704", "amount": "100000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "xrpl:0", "payTo": "rMnHeutYALco8RYFVcmuU4BCgSzBpPEh32", "asset": "XRP", "amount": "100000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "xrpl:0", "payTo": "rMnHeutYALco8RYFVcmuU4BCgSzBpPEh32", "asset": "524C555344000000000000000000000000000000", "amount": "0.1", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:56", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x8d0D000Ee44948FC98c9B98A4FA4921476f08B0d", "amount": "100000000000000000", "maxTimeoutSeconds": 300 } ], "outputSchema": { "bazaar": { "info": { "input": { "method": "GET", "queryParams": { "age": "2 years", "issue": "separation-anxiety", "lang": "es", "species": "dog" }, "type": "http" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "method": { "enum": [ "GET", "HEAD", "DELETE" ], "type": "string" }, "queryParams": { "properties": { "age": { "description": "Pet age (e.g. 2 years)", "type": "string" }, "issue": { "description": "Behavior issue (e.g. separation-anxiety, leash-reactivity, litter-box-avoidance, destructive-chewing, aggression)", "type": "string" }, "lang": { "description": "Response language (e.g. es, de, fr)", "type": "string" }, "species": { "description": "Animal species", "type": "string" } }, "required": [ "species", "issue" ], "type": "object" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method" ], "type": "object" } }, "required": [ "input" ], "type": "object" } }, "builder-code": { "info": { "a": "bc_gxy6qn5p" }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "additionalProperties": false, "properties": { "a": { "description": "App builder code", "pattern": "^[a-z0-9_]{1,32}$", "type": "string" }, "s": { "description": "Service builder codes", "items": { "pattern": "^[a-z0-9_]{1,32}$", "type": "string" }, "type": "array" }, "w": { "description": "Wallet builder code", "pattern": "^[a-z0-9_]{1,32}$", "type": "string" } }, "type": "object" } } }, "tags": [ "bazaar", "builder-code" ], "sourceHost": "petpulse.theaslangroupllc.com", "lastUpdated": "2026-08-20T14:03:12.618Z", "quality": { "calls30d": 1, "uniquePayers30d": 1, "lastCalledAt": "2026-08-20T14:03:12.44Z" }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 14114, "slug": "14114", "resource": "https://herbapulse.theaslangroupllc.com/api/herba/protocol", "description": "Home remedy protocol compiler — practical, safety-railed preparations for a condition or a named remedy: real ratios and steps (teas, tinctures, poultices, castor oil packs), provenance by tradition, an HONEST evidence label per protocol (clinical | preliminary | traditional-use-only), contraindication and drug-interaction cautions, clinician red flags, and a buyable ingredient list with quality specs. Educational, never medical advice.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "150000", "amountUsd": 0.15, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:8453", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "150000", "amountUsd": 0.15, "maxTimeoutSeconds": 604900 }, { "scheme": "exact", "network": "solana:5eykt4UsFv8P8NJdTREpY1vzqKqZKvdp", "payTo": "985iFjbnGQ3dJcwXnfRCMSrH4Jnc3kW1N6msR64B5KX1", "asset": "EPjFWdd5AufqSSqeM2qN1xzybapC8G4wEGGkZwyTDt1v", "amount": "150000", "amountUsd": 0.15, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:137", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x3c499c542cEF5E3811e1192ce70d8cC03d5c3359", "amount": "150000", "amountUsd": 0.15, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:42161", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0xaf88d065e77c8cC2239327C5EDb3A432268e5831", "amount": "150000", "amountUsd": 0.15, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:480", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x79A02482A880bCe3F13E09da970dC34dB4cD24D1", "amount": "150000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:143", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x754704Bc059F8C67012fEd69BC8A327a5aafb603", "amount": "150000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:196", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x779ded0c9e1022225f8e0630b35a9b54be713736", "amount": "150000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:999", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0xb88339CB7199b77E23DB6E890353E22632Ba630f", "amount": "150000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "algorand:wGHE2Pwdvd7S12BL5FaOP20EGYesN73k", "payTo": "62A253YPATFNJCPRKID3FKD77MYJFNTVRYRP4B4JWG36EGLPY7UXFWGI7I", "asset": "31566704", "amount": "150000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "xrpl:0", "payTo": "rMnHeutYALco8RYFVcmuU4BCgSzBpPEh32", "asset": "XRP", "amount": "150000", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "xrpl:0", "payTo": "rMnHeutYALco8RYFVcmuU4BCgSzBpPEh32", "asset": "524C555344000000000000000000000000000000", "amount": "0.15", "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "eip155:56", "payTo": "0x50ab2018c06c6E4eAA9BA52057Eb55eD284912fc", "asset": "0x8d0D000Ee44948FC98c9B98A4FA4921476f08B0d", "amount": "150000000000000000", "maxTimeoutSeconds": 300 } ], "outputSchema": { "bazaar": { "info": { "input": { "method": "GET", "queryParams": { "lang": "en" }, "type": "http" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "method": { "enum": [ "GET", "HEAD", "DELETE" ], "type": "string" }, "queryParams": { "properties": { "audience": { "description": "adult (default) | child | pregnancy — tightens safety rails", "type": "string" }, "condition": { "description": "Condition to compile remedy protocols for (or pass remedy=)", "type": "string" }, "lang": { "description": "Response language (default en)", "type": "string" }, "remedy": { "description": "Specific remedy to compile, e.g. \"castor oil pack\", \"fire cider\"", "type": "string" } }, "type": "object" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method" ], "type": "object" } }, "required": [ "input" ], "type": "object" } }, "builder-code": { "info": { "a": "bc_gxy6qn5p" }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "additionalProperties": false, "properties": { "a": { "description": "App builder code", "pattern": "^[a-z0-9_]{1,32}$", "type": "string" }, "s": { "description": "Service builder codes", "items": { "pattern": "^[a-z0-9_]{1,32}$", "type": "string" }, "type": "array" }, "w": { "description": "Wallet builder code", "pattern": "^[a-z0-9_]{1,32}$", "type": "string" } }, "type": "object" } } }, "tags": [ "bazaar", "builder-code" ], "sourceHost": "herbapulse.theaslangroupllc.com", "lastUpdated": "2026-08-20T14:02:46.03Z", "quality": { "calls30d": 1, "uniquePayers30d": 1, "lastCalledAt": "2026-08-20T14:02:45.863Z" }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 30044, "slug": "30044", "resource": "https://api.macaroonnetwork.com/execute/clinical-trials-search-v1", "description": "Search live clinical trial records from ClinicalTrials.gov: status, phase, conditions, interventions, lead sponsor, eligibility (sex, age range, a short truncated criteria excerpt), and locations. The only source used is the U.S. National Library of Medicine's public ClinicalTrials.gov API v2, available at no charge. Full eligibility-criteria text, full descriptions, and investigator/recruitment contact details are never returned -- only source-linked, truncated summary metadata.", "type": "http", "serviceName": "Macaroon Network", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x33cc8de6e86761d217044a8a6b394ad23b579596", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "3000", "amountUsd": 0.003, "maxTimeoutSeconds": 60 } ], "outputSchema": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "input": { "filters": { "limit": 5, "status": "RECRUITING" }, "query": "find recruiting clinical trials for type 2 diabetes" }, "predicate": { "conditions": [ { "field": "$.results", "type": "count_gte", "value": 1 } ], "type": "all" } }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "payload": { "notices": [], "query": "", "results": [] }, "predicate_passed": true, "settled": true }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST", "PUT", "PATCH" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "DATA LOOKUP", "agent-marketplace", "bazaar" ], "sourceHost": "api.macaroonnetwork.com", "lastUpdated": "2026-10-09T06:38:10.486Z", "quality": { "calls30d": 1, "uniquePayers30d": 1, "lastCalledAt": "2026-10-09T06:38:10.059Z" }, "metadata": { "serviceName": "Macaroon Network", "extensions": { "bazaar": { "info": { "input": { "body": { "input": { "filters": { "limit": 5, "status": "RECRUITING" }, "query": "find recruiting clinical trials for type 2 diabetes" }, "predicate": { "conditions": [ { "field": "$.results", "type": "count_gte", "value": 1 } ], "type": "all" } }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "payload": { "notices": [], "query": "", "results": [] }, "predicate_passed": true, "settled": true }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST", "PUT", "PATCH" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 38000, "slug": "38000", "resource": "https://evidence402.onrender.com/api/v1/brief", "description": "Build a source-linked evidence pack with scholarly papers, bibliography and optional registered clinical trials. Metadata only, no invented findings.", "type": "http", "serviceName": "Evidence402", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:84532", "payTo": "0xc60674058497BfcD73a1b74aCc46B66E1AE5176D", "asset": "0x036CbD53842c5426634e7929541eC2318f3dCF7e", "amount": "50000", "maxTimeoutSeconds": 300 } ], "outputSchema": { "properties": { "example": { "properties": { "data": { "properties": { "clinicalTrials": { "type": "object" }, "literature": { "type": "object" }, "markdown": { "type": "string" } }, "type": "object" }, "requestId": { "type": "string" }, "service": { "type": "string" } }, "required": [ "requestId", "service", "data" ], "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" }, "extensions": { "bazaar": { "info": { "input": { "body": { "includeTrials": true, "limit": 5, "query": "semaglutide obesity" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "data": { "literature": { "papers": [] } }, "requestId": "example-request", "service": "Evidence402" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "$schema": "https://json-schema.org/draft/2020-12/schema", "additionalProperties": false, "properties": { "fromYear": { "maximum": 2026, "minimum": 1900, "type": "integer" }, "includeTrials": { "default": true, "type": "boolean" }, "limit": { "default": 10, "maximum": 20, "minimum": 1, "type": "integer" }, "query": { "maxLength": 250, "minLength": 3, "type": "string" } }, "required": [ "query" ], "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "properties": { "data": { "properties": { "clinicalTrials": { "type": "object" }, "literature": { "type": "object" }, "markdown": { "type": "string" } }, "type": "object" }, "requestId": { "type": "string" }, "service": { "type": "string" } }, "required": [ "requestId", "service", "data" ], "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "research", "citations", "science", "bazaar" ], "sourceHost": "evidence402.onrender.com", "lastUpdated": "2026-10-07T20:29:30.432Z", "quality": { "calls30d": 1, "uniquePayers30d": 1, "lastCalledAt": "2026-10-07T20:29:30.209Z" }, "metadata": { "serviceName": "Evidence402", "extensions": { "bazaar": { "info": { "input": { "body": { "includeTrials": true, "limit": 5, "query": "semaglutide obesity" }, "bodyType": "json", "method": "POST", "type": "http" }, "output": { "example": { "data": { "literature": { "papers": [] } }, "requestId": "example-request", "service": "Evidence402" }, "type": "json" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "body": { "$schema": "https://json-schema.org/draft/2020-12/schema", "additionalProperties": false, "properties": { "fromYear": { "maximum": 2026, "minimum": 1900, "type": "integer" }, "includeTrials": { "default": true, "type": "boolean" }, "limit": { "default": 10, "maximum": 20, "minimum": 1, "type": "integer" }, "query": { "maxLength": 250, "minLength": 3, "type": "string" } }, "required": [ "query" ], "type": "object" }, "bodyType": { "enum": [ "json", "form-data", "text" ], "type": "string" }, "method": { "enum": [ "POST" ], "type": "string" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method", "bodyType", "body" ], "type": "object" }, "output": { "properties": { "example": { "properties": { "data": { "properties": { "clinicalTrials": { "type": "object" }, "literature": { "type": "object" }, "markdown": { "type": "string" } }, "type": "object" }, "requestId": { "type": "string" }, "service": { "type": "string" } }, "required": [ "requestId", "service", "data" ], "type": "object" }, "type": { "type": "string" } }, "required": [ "type" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 54491, "slug": "54491", "resource": "https://monitor.memoryapi.org/x402/monitor/activity?", "description": "x402 API activity stats — top endpoints by paid calls, trend data, and unique payer counts from memoryapi.org nginx logs.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x24FAcafEB49b4e3FACF0B3e69604A2F4640c9bf2", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "1000", "amountUsd": 0.001, "maxTimeoutSeconds": 300 } ], "outputSchema": { "example": { "period_hours": 24, "source": "memoryapi.org nginx logs", "success": true, "top_endpoints": [ { "calls": 87, "endpoint": "/x402/clinical/study", "trend": "up" } ], "total_paid_calls": 142 } }, "extensions": { "bazaar": { "info": { "description": "Get x402 paid API call activity from memoryapi.org. Returns top endpoints, call counts, and trends.", "iconUrl": "https://memoryapi.org/icon.png", "input": { "method": "GET", "queryParams": { "hours": "24", "service": "clinical" }, "schema": { "properties": { "hours": { "description": "Lookback window in hours (1-168, default 24)", "type": "string" }, "service": { "description": "Filter by service name (e.g. clinical, bio, research)", "type": "string" } }, "required": [] }, "type": "http" }, "output": { "example": { "period_hours": 24, "source": "memoryapi.org nginx logs", "success": true, "top_endpoints": [ { "calls": 87, "endpoint": "/x402/clinical/study", "trend": "up" } ], "total_paid_calls": 142 } }, "serviceName": "MemoryAPI Monitor", "tags": [ "monitoring", "analytics", "agents" ] }, "schema": { "properties": { "input": { "properties": { "method": { "enum": [ "GET" ], "type": "string" } }, "required": [ "method" ] } } } } }, "tags": [ "bazaar" ], "sourceHost": "monitor.memoryapi.org", "lastUpdated": "2026-10-02T13:50:47.855Z", "quality": { "calls30d": 1, "uniquePayers30d": 1, "lastCalledAt": "2026-10-02T13:50:47.643Z" }, "metadata": { "extensions": { "bazaar": { "info": { "description": "Get x402 paid API call activity from memoryapi.org. Returns top endpoints, call counts, and trends.", "iconUrl": "https://memoryapi.org/icon.png", "input": { "method": "GET", "queryParams": { "hours": "24", "service": "clinical" }, "schema": { "properties": { "hours": { "description": "Lookback window in hours (1-168, default 24)", "type": "string" }, "service": { "description": "Filter by service name (e.g. clinical, bio, research)", "type": "string" } }, "required": [] }, "type": "http" }, "output": { "example": { "period_hours": 24, "source": "memoryapi.org nginx logs", "success": true, "top_endpoints": [ { "calls": 87, "endpoint": "/x402/clinical/study", "trend": "up" } ], "total_paid_calls": 142 } }, "serviceName": "MemoryAPI Monitor", "tags": [ "monitoring", "analytics", "agents" ] }, "schema": { "properties": { "input": { "properties": { "method": { "enum": [ "GET" ], "type": "string" } }, "required": [ "method" ] } } } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false }, { "id": 56937, "slug": "56937", "resource": "https://api.cn402.com/tcm/herb", "description": "TCM herb lookup, Chinese herbal medicine, 中药, Chinese medicinal herbs, herb properties, herb meridian, herb temperature, 寒热温凉, herb taste, 酸甘苦辛咸, Traditional Chinese herbal materia medica. Look up Chinese herbs with traditional properties (nature, taste, meridian) and clinical uses. Accepts payment on Base or Solana — either network works.", "type": "http", "resourceType": "Healthcare", "x402Version": 2, "accepts": [ { "scheme": "exact", "network": "eip155:8453", "payTo": "0x4466d4A84b7c49a6A094ec6eef4a0712D6dd125e", "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913", "amount": "16000", "amountUsd": 0.016, "maxTimeoutSeconds": 300 }, { "scheme": "exact", "network": "solana:5eykt4UsFv8P8NJdTREpY1vzqKqZKvdp", "payTo": "9urRvUx69HqAopg1JGV9P9wR7JdKoztzdkuNyJ8Eo1up", "asset": "EPjFWdd5AufqSSqeM2qN1xzybapC8G4wEGGkZwyTDt1v", "amount": "16000", "amountUsd": 0.016, "maxTimeoutSeconds": 300 } ], "extensions": { "bazaar": { "info": { "input": { "method": "GET", "queryParams": { "name": "string" }, "type": "http" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "method": { "enum": [ "GET" ], "type": "string" }, "queryParams": { "properties": { "name": { "description": "ENS name e.g. vitalik.eth (optional)", "type": "string" } }, "type": "object" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } }, "tags": [ "bazaar" ], "sourceHost": "api.cn402.com", "lastUpdated": "2026-09-25T19:01:46.523Z", "quality": { "calls30d": 1, "uniquePayers30d": 1, "lastCalledAt": "2026-09-25T19:01:46.205Z" }, "metadata": { "extensions": { "bazaar": { "info": { "input": { "method": "GET", "queryParams": { "name": "string" }, "type": "http" } }, "schema": { "$schema": "https://json-schema.org/draft/2020-12/schema", "properties": { "input": { "additionalProperties": false, "properties": { "method": { "enum": [ "GET" ], "type": "string" }, "queryParams": { "properties": { "name": { "description": "ENS name e.g. vitalik.eth (optional)", "type": "string" } }, "type": "object" }, "type": { "const": "http", "type": "string" } }, "required": [ "type", "method" ], "type": "object" } }, "required": [ "input" ], "type": "object" } } } }, "liveness": { "reliability": null }, "verified": false, "featured": false } ] }