Saylor Innovations Agent Bazaar by Saylor Innovations
Connect an Agent
mirrored listing x402 eip155:8453

Slides each caller-supplied spacer over a bounded phage sequence in both orientations, rec

Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.

Do you run bio.halowerk.com? This listing was mirrored from Coinbase's public Bazaar. Claim it in 30 seconds — no account required — and it becomes verified, permanently overriding the mirrored copy.

Claim this listing
4000 (raw units)
price
1
calls / 30d
1
unique payers
2026-09-01
updated

Provider

bio.halowerk.com · discovered, not yet claimed by its owner

Payment (x402 accepts[])

[
  {
    "scheme": "exact",
    "network": "eip155:8453",
    "payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
    "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
    "amount": "4000",
    "maxTimeoutSeconds": 300
  }
]

Output schema

{
  "bazaar": {
    "info": {
      "input": {
        "body": {
          "max_mismatches": 2,
          "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
          "spacers": [
            {
              "id": "spacer-1",
              "sequence": "GGCTAACCGTTCGATC"
            },
            {
              "id": "spacer-2",
              "sequence": "ATGCCTGAATTCGGCA"
            }
          ]
        },
        "bodyType": "json",
        "method": "POST",
        "type": "http"
      }
    },
    "schema": {
      "$schema": "https://json-schema.org/draft/2020-12/schema",
      "properties": {
        "input": {
          "additionalProperties": false,
          "properties": {
            "body": {
              "additionalProperties": false,
              "properties": {
                "max_mismatches": {
                  "maximum": 5,
                  "minimum": 0,
                  "type": "integer"
                },
                "phage_sequence": {
                  "maxLength": 10000,
                  "minLength": 1,
                  "pattern": "^[ACGT]+$",
                  "type": "string"
                },
                "spacers": {
                  "items": {
                    "additionalProperties": false,
                    "properties": {
                      "id": {
                        "maxLength": 128,
                        "minLength": 1,
                        "type": "string"
                      },
                      "sequence": {
                        "maxLength": 60,
                        "minLength": 15,
                        "pattern": "^[ACGT]+$",
                        "type": "string"
                      }
                    },
                    "required": [
                      "id",
                      "sequence"
                    ],
                    "type": "object"
                  },
                  "maxItems": 50,
                  "minItems": 1,
                  "type": "array"
                }
              },
              "required": [
                "phage_sequence",
                "spacers",
                "max_mismatches"
              ],
              "type": "object"
            },
            "bodyType": {
              "enum": [
                "json",
                "form-data",
                "text"
              ],
              "type": "string"
            },
            "method": {
              "enum": [
                "POST",
                "PUT",
                "PATCH"
              ],
              "type": "string"
            },
            "type": {
              "const": "http",
              "type": "string"
            }
          },
          "required": [
            "type",
            "method",
            "bodyType",
            "body"
          ],
          "type": "object"
        }
      },
      "required": [
        "input"
      ],
      "type": "object"
    }
  }
}

Use it

curl

curl "https://bio.halowerk.com/v1/phage-matching"
# -> 402 Payment Required, accepts[] lists how to pay
# retry with a PAYMENT-SIGNATURE (or PAYMENT header) once paid

JavaScript

const res = await fetch("https://bio.halowerk.com/v1/phage-matching");
if (res.status === 402) {
  const { accepts } = await res.json();
  // pay one of accepts[] via an x402 client, then retry with the payment header
}

Python

import httpx
res = httpx.get("https://bio.halowerk.com/v1/phage-matching")
if res.status_code == 402:
    accepts = res.json()["accepts"]
    # pay one of accepts[] via an x402 client, then retry with the payment header

Machine-readable

Everything on this page is also available as clean JSON at /resources/15249.json, and this resource appears in /discovery/resources and /discovery/search.