{
  "x402Version": 2,
  "id": 15255,
  "slug": "15255",
  "resource": "https://bio.halowerk.com/v1/crispr-offtarget",
  "description": "Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.",
  "type": "http",
  "accepts": [
    {
      "scheme": "exact",
      "network": "eip155:8453",
      "payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
      "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
      "amount": "4000",
      "maxTimeoutSeconds": 300
    }
  ],
  "outputSchema": {
    "bazaar": {
      "info": {
        "input": {
          "body": {
            "candidates": [
              {
                "id": "candidate-1",
                "pam": "AGG",
                "protospacer": "GAGTCCGAGCAGAAGAAGAA"
              },
              {
                "id": "candidate-2",
                "pam": "TGG",
                "protospacer": "GAGTCCGAGCAGAAGATGAA"
              },
              {
                "id": "candidate-3",
                "pam": "TGA",
                "protospacer": "GACTCCGAGCAGAAGAAGAT"
              }
            ],
            "guide": "GAGTCCGAGCAGAAGAAGAA"
          },
          "bodyType": "json",
          "method": "POST",
          "type": "http"
        }
      },
      "schema": {
        "$schema": "https://json-schema.org/draft/2020-12/schema",
        "properties": {
          "input": {
            "additionalProperties": false,
            "properties": {
              "body": {
                "additionalProperties": false,
                "properties": {
                  "candidates": {
                    "items": {
                      "additionalProperties": false,
                      "properties": {
                        "id": {
                          "maxLength": 128,
                          "minLength": 1,
                          "type": "string"
                        },
                        "pam": {
                          "maxLength": 8,
                          "minLength": 2,
                          "pattern": "^[ACGT]+$",
                          "type": "string"
                        },
                        "protospacer": {
                          "maxLength": 30,
                          "minLength": 17,
                          "pattern": "^[ACGT]+$",
                          "type": "string"
                        }
                      },
                      "required": [
                        "id",
                        "protospacer",
                        "pam"
                      ],
                      "type": "object"
                    },
                    "maxItems": 1000,
                    "minItems": 1,
                    "type": "array"
                  },
                  "guide": {
                    "description": "Guide sequence written 5-prime to 3-prime.",
                    "maxLength": 30,
                    "minLength": 17,
                    "pattern": "^[ACGT]+$",
                    "type": "string"
                  }
                },
                "required": [
                  "guide",
                  "candidates"
                ],
                "type": "object"
              },
              "bodyType": {
                "enum": [
                  "json",
                  "form-data",
                  "text"
                ],
                "type": "string"
              },
              "method": {
                "enum": [
                  "POST",
                  "PUT",
                  "PATCH"
                ],
                "type": "string"
              },
              "type": {
                "const": "http",
                "type": "string"
              }
            },
            "required": [
              "type",
              "method",
              "bodyType",
              "body"
            ],
            "type": "object"
          }
        },
        "required": [
          "input"
        ],
        "type": "object"
      }
    }
  },
  "tags": [
    "bazaar"
  ],
  "sourceHost": "bio.halowerk.com",
  "lastUpdated": "2026-09-01T07:52:49.998Z",
  "quality": {
    "calls30d": 1,
    "uniquePayers30d": 1,
    "lastCalledAt": "2026-09-01T07:52:49.554Z"
  },
  "liveness": {},
  "verified": false,
  "featured": false,
  "provider": {
    "host": "bio.halowerk.com",
    "manifest_name": "bio.halowerk.com",
    "source": "cdp-mirror",
    "source_manifest_url": "https://api.cdp.coinbase.com/platform/v2/x402/discovery/resources",
    "submitted_at": "2026-09-18T22:00:31.484Z"
  }
}