Compares one guide with caller-supplied candidate protospacers, weights mismatches in the
Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.
4000 (raw units)
price
1
calls / 30d
1
unique payers
2026-09-01
updated
Provider
bio.halowerk.com · discovered, not yet claimed by its owner
Payment (x402 accepts[])
[
{
"scheme": "exact",
"network": "eip155:8453",
"payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
"asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
"amount": "4000",
"maxTimeoutSeconds": 300
}
]Output schema
{
"bazaar": {
"info": {
"input": {
"body": {
"candidates": [
{
"id": "candidate-1",
"pam": "AGG",
"protospacer": "GAGTCCGAGCAGAAGAAGAA"
},
{
"id": "candidate-2",
"pam": "TGG",
"protospacer": "GAGTCCGAGCAGAAGATGAA"
},
{
"id": "candidate-3",
"pam": "TGA",
"protospacer": "GACTCCGAGCAGAAGAAGAT"
}
],
"guide": "GAGTCCGAGCAGAAGAAGAA"
},
"bodyType": "json",
"method": "POST",
"type": "http"
}
},
"schema": {
"$schema": "https://json-schema.org/draft/2020-12/schema",
"properties": {
"input": {
"additionalProperties": false,
"properties": {
"body": {
"additionalProperties": false,
"properties": {
"candidates": {
"items": {
"additionalProperties": false,
"properties": {
"id": {
"maxLength": 128,
"minLength": 1,
"type": "string"
},
"pam": {
"maxLength": 8,
"minLength": 2,
"pattern": "^[ACGT]+$",
"type": "string"
},
"protospacer": {
"maxLength": 30,
"minLength": 17,
"pattern": "^[ACGT]+$",
"type": "string"
}
},
"required": [
"id",
"protospacer",
"pam"
],
"type": "object"
},
"maxItems": 1000,
"minItems": 1,
"type": "array"
},
"guide": {
"description": "Guide sequence written 5-prime to 3-prime.",
"maxLength": 30,
"minLength": 17,
"pattern": "^[ACGT]+$",
"type": "string"
}
},
"required": [
"guide",
"candidates"
],
"type": "object"
},
"bodyType": {
"enum": [
"json",
"form-data",
"text"
],
"type": "string"
},
"method": {
"enum": [
"POST",
"PUT",
"PATCH"
],
"type": "string"
},
"type": {
"const": "http",
"type": "string"
}
},
"required": [
"type",
"method",
"bodyType",
"body"
],
"type": "object"
}
},
"required": [
"input"
],
"type": "object"
}
}
}Use it
curl
curl "https://bio.halowerk.com/v1/crispr-offtarget" # -> 402 Payment Required, accepts[] lists how to pay # retry with a PAYMENT-SIGNATURE (or PAYMENT header) once paid
JavaScript
const res = await fetch("https://bio.halowerk.com/v1/crispr-offtarget");
if (res.status === 402) {
const { accepts } = await res.json();
// pay one of accepts[] via an x402 client, then retry with the payment header
}Python
import httpx
res = httpx.get("https://bio.halowerk.com/v1/crispr-offtarget")
if res.status_code == 402:
accepts = res.json()["accepts"]
# pay one of accepts[] via an x402 client, then retry with the payment headerMachine-readable
Everything on this page is also available as clean JSON at /resources/15255.json, and this resource appears in /discovery/resources and /discovery/search.