mirrored listing x402 eip155:8453

Compares one guide with caller-supplied candidate protospacers, weights mismatches in the

Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.

Do you run bio.halowerk.com? This listing was mirrored from Coinbase's public Bazaar. Claim it in 30 seconds — no account required — and it becomes verified, permanently overriding the mirrored copy.

Claim this listing
4000 (raw units)
price
1
calls / 30d
1
unique payers
2026-09-01
updated

Provider

bio.halowerk.com · discovered, not yet claimed by its owner

Payment (x402 accepts[])

[
  {
    "scheme": "exact",
    "network": "eip155:8453",
    "payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
    "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
    "amount": "4000",
    "maxTimeoutSeconds": 300
  }
]

Output schema

{
  "bazaar": {
    "info": {
      "input": {
        "body": {
          "candidates": [
            {
              "id": "candidate-1",
              "pam": "AGG",
              "protospacer": "GAGTCCGAGCAGAAGAAGAA"
            },
            {
              "id": "candidate-2",
              "pam": "TGG",
              "protospacer": "GAGTCCGAGCAGAAGATGAA"
            },
            {
              "id": "candidate-3",
              "pam": "TGA",
              "protospacer": "GACTCCGAGCAGAAGAAGAT"
            }
          ],
          "guide": "GAGTCCGAGCAGAAGAAGAA"
        },
        "bodyType": "json",
        "method": "POST",
        "type": "http"
      }
    },
    "schema": {
      "$schema": "https://json-schema.org/draft/2020-12/schema",
      "properties": {
        "input": {
          "additionalProperties": false,
          "properties": {
            "body": {
              "additionalProperties": false,
              "properties": {
                "candidates": {
                  "items": {
                    "additionalProperties": false,
                    "properties": {
                      "id": {
                        "maxLength": 128,
                        "minLength": 1,
                        "type": "string"
                      },
                      "pam": {
                        "maxLength": 8,
                        "minLength": 2,
                        "pattern": "^[ACGT]+$",
                        "type": "string"
                      },
                      "protospacer": {
                        "maxLength": 30,
                        "minLength": 17,
                        "pattern": "^[ACGT]+$",
                        "type": "string"
                      }
                    },
                    "required": [
                      "id",
                      "protospacer",
                      "pam"
                    ],
                    "type": "object"
                  },
                  "maxItems": 1000,
                  "minItems": 1,
                  "type": "array"
                },
                "guide": {
                  "description": "Guide sequence written 5-prime to 3-prime.",
                  "maxLength": 30,
                  "minLength": 17,
                  "pattern": "^[ACGT]+$",
                  "type": "string"
                }
              },
              "required": [
                "guide",
                "candidates"
              ],
              "type": "object"
            },
            "bodyType": {
              "enum": [
                "json",
                "form-data",
                "text"
              ],
              "type": "string"
            },
            "method": {
              "enum": [
                "POST",
                "PUT",
                "PATCH"
              ],
              "type": "string"
            },
            "type": {
              "const": "http",
              "type": "string"
            }
          },
          "required": [
            "type",
            "method",
            "bodyType",
            "body"
          ],
          "type": "object"
        }
      },
      "required": [
        "input"
      ],
      "type": "object"
    }
  }
}

Use it

curl

curl "https://bio.halowerk.com/v1/crispr-offtarget"
# -> 402 Payment Required, accepts[] lists how to pay
# retry with a PAYMENT-SIGNATURE (or PAYMENT header) once paid

JavaScript

const res = await fetch("https://bio.halowerk.com/v1/crispr-offtarget");
if (res.status === 402) {
  const { accepts } = await res.json();
  // pay one of accepts[] via an x402 client, then retry with the payment header
}

Python

import httpx
res = httpx.get("https://bio.halowerk.com/v1/crispr-offtarget")
if res.status_code == 402:
    accepts = res.json()["accepts"]
    # pay one of accepts[] via an x402 client, then retry with the payment header

Machine-readable

Everything on this page is also available as clean JSON at /resources/15255.json, and this resource appears in /discovery/resources and /discovery/search.